Please wait a minute...
Clinical and Experimental Obstetrics & Gynecology  2020, Vol. 47 Issue (3): 424-426    DOI: 10.31083/j.ceog.2020.03.5215
Case Report Previous articles | Next articles
Recurrent hydatidiform mole: when to stop?
E. Ozbasli1, *(), O. Takmaz1, H. Gurkan2, Y. Alanay1, M. Gungor1, F.S. Dede1
1Department of Obstetrics and Gynecology, Acibadem University School of Medicine, Istanbul, Turkey
2Diagnostics Center for Genetic Diseases, University of Trakya, Trakya Medical Faculty, Edirne, Turkey
Download:  PDF(154KB)  ( 153 ) Full text   ( 4 )
Export:  BibTeX | EndNote (RIS)      

Recurrent hydatidiform mole (RHM) is defined as two or more repeated molar pregnancies in the same patient. Familial recurrent hydatidiform mole (FRHM) is a rare condition in which the patient has relatives with the same condition and mutations. Maternal mutations in the NLRP7 gene are mostly observed in RHM. The authors report a patient from Turkey with a history of seven molar pregnancies who had an aunt with similar obstetric history and NLRP7 mutations.

Key words:  Familial hydatidiform mole      NLRP7      Ovum donation      Genomic imprinting     
Submitted:  04 March 2019      Accepted:  04 June 2019      Published:  15 June 2020     
*Corresponding Author(s):  ESRA OZBASLI     E-mail:

Cite this article: 

E. Ozbasli, O. Takmaz, H. Gurkan, Y. Alanay, M. Gungor, F.S. Dede. Recurrent hydatidiform mole: when to stop?. Clinical and Experimental Obstetrics & Gynecology, 2020, 47(3): 424-426.

URL:     OR

Table 1  — PCR conditions of primers used in NLRP7 mutation analysis
Exon Primer sequences (5’-3’) T (°C) Size (bp)
10 Forward 10-1 ACACGCTTGAGCCACTACCT 60 205
11 Forward 11-1 TTCAGGCATCCTGGGTAGTT 55.5 278
[1] Bracken M.B.: “Incidence and aetiology of hydatidiform mole: an epidemiological review”. BJOG, 1987, 94, 1123.
doi: 10.1111/bjo.1987.94.issue-12
[2] Lai C.Y., Chan K.Y., Khoo U.S., Ngan H.Y., Xue W.C., Chiu P.M., et al.: “Analysis of gestational trophoblastic disease by genotyping and chromosome in situ hybridization”. Mod. Pathol., 2004, 17, 40.
doi: 10.1038/modpathol.3800010 pmid: 14631372
[3] Sebire N.J., Fisher R.A., Foskett M., Rees H., Seckl M.J., Newlands E.S.: “Risk of recurrent hydatidiform mole and subsequent pregnancy outcome following complete or partial hydatidiform molar pregnancy”. BJOG, 2003, 110, 22.
pmid: 12504931
[4] Murdoch S., Djuric U., Mazhar B., Seoud M., Khan R., Kuick R.: “Mutations in NALP7 cause recurrent hydatidiform moles and reproductive wastage in humans”. Nat. Genet., 2006, 38, 300.
doi: 10.1038/ng1740 pmid: 16462743
[5] Hayward B.E., De Vos M., Talati N., Abdollahi M.R., Taylor G.R., Meyer E., et al.: “Genetic and epigenetic analysis of recurrent hydatidiform mole”. Hum. Mutat., 2009, 30, 629.
[6] Buyukkurt S., Fisher R.A., Vardar M.A., Evruke C.: “Heterogeneity in recurrent complete hydatidiform mole: Presentation of two new Turkish families with different genetic characteristics”. Placenta, 2010, 31, 1023.
doi: 10.1016/j.placenta.2010.09.003
[7] Akoury E., Gupta N., Bagga R., Brown S., Déry C., Kabra M., et al.: “Live births in women with recurrent hydatidiform mole and two NLRP7 mutations”. Reprod. Biomed. Online, 2015, 31, 120.
doi: 10.1016/j.rbmo.2015.03.011 pmid: 25982095
[8] Al-Ghamdi A.: “Recurrent hydatidiform mole: A case report of six consecutive molar pregnancies complicated by choriocarcinoma, and review of the literature”. J. Fam. Community Med., 2011, 18, 159.
doi: 10.4103/2230-8229.90018
[9] Fisher R.A., Lavery S.A., Carby A., Abu-Hayyeh S., Swingler R., Sebire N.J., Seckl M.J.: “What a difference an egg makes”. Lancet, 2011, 378, 1974.
doi: 10.1016/S0140-6736(11)61751-0 pmid: 22130487
No related articles found!
No Suggested Reading articles found!